800.227.0627

What is the MARIO method or technology?

MARIO refers to a method or technology called
Mapping RNA interactome in vivo."


MARIO reveals RNA–RNA interactions from unperturbed cells. (Nguyen et al. 2016)

(1)  MARIO allows the direct analyses of endogenous cellular features without

       introducing any exogenous nucleotides or protein-coding genes before
       cross-linking.

(2)  Introduction of a selectable linker enables an unbiased selection of interacting
       RNAs. MARIO enables global mapping of an RNA–RNA interactome.

(3)  MARIO only captures the RNA molecules co-bound with a single protein molecule.
       The capture of RNA molecules that are independently bound to different copies of
       a protein is avoided.

(4)  False positives resulting from RNAs ligating randomly to other nearby RNAs are
       minimized by performing the RNA ligation step on streptavidin beads in extremely
       dilute conditions.

(5)  The RNA linker used provides a clear boundary delineating the position of ligation
       site in the sequencing reads, avoiding ambiguities in mapping the ligated chimeric
       RNA.

(6)  Potential PCR amplification biases are removed by attaching a random four-
        or six-nucleotide barcode to each chimeric RNA before PCR amplification and
        subsequently counting completely overlapping sequencing reads with identical
        barcodes only once.


[Source: 
Nguyen et al. 2016


What does MARIO do?

MARIO allows

(i)    The capture of interacting RNAs in vivo in an unbiased manner without genetically
         or transiently introducing exogenous molecules; 

(ii)    Stringent removal of non-physiologic associations that form after cell lysis; 

(iii)   Selects proximity-ligated chimeric RNAs; and 

(iv)   Unambiguous bioinformatic identification of interacting RNAs

How does MARIO work ?

MARIO starts with the cross-linking of RNAs to proteins in cells. The major experimental steps needed are as follows: 

(1)  Cross-linking and immobilization of all RNA–protein complexes in streptavidin
        beads and removal of nonspecific binding by denaturing conditions; 

(2)  RNA fragmentation, protein denaturing and biotinylation; 

(3)  Immobilization of RNA-binding proteins at low density; 

(4)  Ligation of a biotinylated RNA linker to facilitate selective enrichment of
       chimeric RNA constructs. The linker sequence splits the interacting RNAs
       from a sequencing read pair.
       A biotin-tagged RNA linker 
is attached to the RNA’s 5′-end
       (5′- rCrUrArG/iBiodT/rArGrCrCrCrArUrGrCrArArUrG rCrGrArGrGrA -3′); 

(5)  Proximity ligation under a dilute condition; 

(6)  RNA purification and RT; 

(7)  Biotin pull-down; and 

(8)  Construction of sequencing library.


What does MARIO reveal?

(A)  MARIO maps RNA–RNA interactions in a massive scale. 

(B)  MARIO can identify protein-assisted between-molecule and within-molecule
         RNA interactions. 

(C)  The MARIO identified RNA–RNA interactome is composed of tens of thousands of
       interactions, which involve mRNA, long intergenic noncoding RNA (lincRNA),
       small nucleolar RNA (snoRNA), small nuclear RNA, tRNA, miRNA, transposon
       RNA, pseudogene RNA, antisense RNA and novel transcripts. 

(D)  The identified RNA–RNA interactome is a scale-free network. 

(E)   Long non-coding RNA including lincRNA, transposon RNA, and pseudogene RNA
        are observed to interact with mRNA. 

(F)   Sequence complementation is observed in interactions between transposon
       (LINE and LTR) RNA and mRNA, as well as in mRNA–mRNA,
        mRNA–peudogene RNA, lincRNA–mRNA, miRNA–mRNA and LINE–miRNA
        interactions. 

(G)  MARIO data also provide spatial-proximity information related to RNA folding in
       three-dimensional space.

Examples of oligonucleotide sequences used for MARIO

Custom-designed RNA and DNA oligonucleotides used in the procedure are listed below.

 (All oligonucleotides used are free of RNase and are HPLC-purified):

 

 

5′- ------------------------------------------------------------------- -3′

Biotinylated RNA linker

rCrUrArG/iBiodT/rArGrCrCrCrArUrGrCrArArUrGrCrGrArGrGrA

cDNA strand with RNA linker

T*C*G*C*ATTGCATGGGCTACTAGCAT

* denotes phosphor thioate bonds to block digestion by T7 exonuclease.

Pre-adenylated RT adapter

/5rApp/AGATCGGAAGAGCGGTTCAG/3ddC/

 

 

Primer for the ES-1 sample:

/5Phos/NNAGGTNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGCTCTTCCGATCT

RT Primer for the ES-2 and MEF samples (sequenced on different lanes):

/5Phos/NNCGCCNNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGCTCTTCCGATCT

RT Primer for the ES-indirect sample:

/5Phos/NNCATTNNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGCTCTTCCGATCT

Cut_oligo

GTTCAGGATCCACGACGCTCTTCAAAA/3InvdT/.

BamHI restriction site is highlighted

Truncated PCR Forward Primer DP5

 CACGACGCTCTTCCGATCT

 

Truncated PCR Reverse Primer DP3

 CTGAACCGCTCTTCCGATCT

 

Illumina PE PCR Forward Primer 1.0

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT

Illumina PE PCR Reverse Primer 2.0

CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT

 


Reference

Nguyen, Tri C., Cao, Xiaoyi, Yu, Pengfei, Xiao, Shu, Lu, Jia,  Biase, Fernando H., Sridhar, Bharat, Huang, Norman, Zhang, Kang, and Zhong, Sheng; Mapping RNA-RNA interactome and RNA structure in vivo by MARIO. Nature Communications 2016,7, 12023. 

---...---