BNAs for Duplex and Triplex Formation

2’,4’-BNA (LNA) with a five-membered bridged structure is insufficiently resistant to nucleases, and fully modified 2’,4’-BNA (LNA) oligonucleotides do not have the flexibility required for efficient triplex formation.

BNA analogues with increased steric bulk and less conformational restriction were developed. 2’,4’-BNACOC has a seven membered bridged structure and exhibits dramatically improved nuclease resistance.

NA-5 = BNA^COC: This modification conversely affects duplex stability [i.e., duplexes formed with this nucleic acid analogue are less stable than those formed by 2’,4’-BNA (LNA)].

ENA, with a six-membered bridged structure, has slightly lower duplex-forming ability and significantly higher nuclease resistance than 2’,4’-BNA (LNA).

Triplex formation with ENA provided variable results compared to that of 2’,4’-BNA (LNA).

2’,4’-BNA^NC, has a six-membered bridged structure with a unique structural feature (N-O bond) in the sugar moiety. The bridged moiety was designed to have a nitrogen atom, which can:

(i)  Act as a conjugation site

(ii) (I(ii) mprove duplex and triplex stability by lowering repulsions between the negatively charged backbone phosphates

The nitrogen atom on the bridge can be functionalized by hydrophobic and hydrophilic groups, by steric bulk, or by appropriate functional moieties to:

(i)    Control affinity toward complementary strands
(ii)   Regulate resistance against nuclease degradation, and
(iii)  Allows synthesis of functional molecules designed for specific applications in genomics.

In addition to the above possibilities, the N-O bond could be cleaved under appropriate reductive conditions to modulate the hybridizing properties of 2’,4’-BNA^NC.

Duplex formation with 2’,4’-BNA^NC[NH] chimer:

Duplex formation with 2’,4’-BNA (LNA) chimer:

Duplex formation with 2’,4’-BNA^NC[NMe] chimer:

Duplex formation with 2’,4’-BNA(LNA) chimer:

Conclusion:

ΔT_m values in the Table show that any mismatched base in the target RNA strand resulted in a substantial decrease in the T_m of duplexes formed with 2’,4’-BNA^NC-modified oligonucleotides.

ΔT_m values of duplexes formed with 2’,4’-BNA^NC[NH]-modified oligonucleotide having T-U, T-G, and T-C arrangements are -14, -5, -17 °C.

These are lower than those of the corresponding natural DNA-RNA duplexes (ΔTm= -12, -3, and -15 °C, respectively).

Similar to those exhibited by duplexes formed with the 2’,4’-BNA (LNA) oligonucleotide (ΔTm= -13, -5, and -17 °C, respectively).

The mismatch discrimination profiles of 2’,4’-BNA^NC[NMe] and [NBn] were also similar to that of 2’,4’-BNA (LNA), except in the case of the T-G arrangement for the 2’,4’-BNA^NC[NMe] derivative, as shown in the Table.

Thus, it appears that 2’,4’-BNA^NC not only exhibits high-affinity RNA selective hybridization, but is also highly selective in recognizing bases.

a Target dsDNA:	5’-d(GCTAAAAAGAAAGAGAGATCG)-3’ 3’-d(CGATTTTTCTTTCTCTCTAGC)-5’
underlined portion indicates the target site for triplex formation. b Conditions: 7 mM sodium phosphate buffer (pH 7.0) containing 140 mM KCl; strand concentration = 1.5 µM. c Data from Rahman et al. 2007. Conclusion: Oligonucleotides with 2’,4’-BNANC[NH] monomers form more stable TFOs when compared to 2’,4’-BNANC[NMe] and LNAs. Proper spacing of the monomers appears to make the binding stronger. The best placement of BNANC[NH] monomers for triplex probes is:
d(TTTTTmCTTTmCTmCTmCT)
This design appears to be the best for the design of probes that form stable triplexes under physiological conditions!   This is similar or close to LNA oligos. 2’,4’-BNANC[NH] oligos form more stable TFOs.
Molecular models of Triplexes
Molecular modeling of a parallel-motif triplex formed by 2’,4’-BNANC[NH]-TFO with dsDNA. BNA: d(TTTTTmCTTTmCTmCTmCT). (Source: Rahman et al., 2008). (A) The overall view of the triplex is depicted. The dsDNA is shown as a gray CPK model with the phosphate backbone of the purine strand colored red and purple. TFO is shown as a colored tube model with three 20,40-BNANC nitrogens represented in green. (B) Expanded view of the area of the triplex containing three consecutive 20,40-BNANC[NH] residues. Note that the 20,40-BNANC nitrogens are very close to the phosphate moiety of the purine strand indicating ionic interactions of the compounds.