Contact Us
800.227.0627

Custom RNA Synthesis

Custom RNA Synthesis

RNA Oligo Synthesis

Bio-Synthesis supplies Custom RNA Oligo Synthesis services for a wide range of labels, modifications, scales and purities. We provide RNA synthesis for long RNA oligos up to 300 bases.

RNA oligos are synthesized using the latest nucleic acid technology and are purified using RNase free PAGE electrophoresis combined with HPLC. Our RNA oligonucleotide synthesis services are provided with mass spectrometric analysis. Purified RNA oligonucleotides come with stringent analytical HPLC or gel electrophoresis to determine final purity.

RNA oligonucleotides are processed using our RNaseSAFETM service, in which RNA oligos are packaged in RNase free matrix tubes to prevent degradation during shipping and storage. This standard service helps safeguard the biological activity of RNA oligos.

For additional information on RNA synthesis services such as RNAi, siRNA, shRNA, mRNA, please contact us or send an email to info@biosyn.com.

RNA synthesis and deprotection is performed using proprietary parallel synthesis and deprotection technologies. This advanced technology enables us to synthesize oligos with higher coupling efficiency and fast deprotection, resulting in quick turnaround time.

RNA Synthesis Services

  • Deprotected, desalted and ready to use
  • Multi-scale capacity (large scale, multi-gram)
  • Purification by RNase free -PAGE or RP-HPLC upon request
  • QC analysis by MALDI-TOF Mass spectrometry, HPLC, PAGE analysis
  • Packaged in an inert chemical matrix - inactivated and stabilized during handling
  • Fast delivery and high throughput capacity

Specialty RNA Synthesis:

  • Long RNA Synthesis (up to 300 bases): Our long RNA synthesis success rate exceeds most industry standards
  • Flexible synthesis platform:  Combining solid phase and ligation technologies results in successful synthesis of highly complex RNA oligos
  • State-of-the art laboratory: High-throughput, large volume, large scale, multi-gram synthesizers
  • Extensive experience: Long standing history of providing custom oligonucleotide since 1998

Commitment to Quality:

  • Our Total Quality Management (TQM) platform ensures delivery of high-quality RNA oligos
  • All Custom RNA oligos are manufactured under strict SOP quality control processes
  • High resolution ion-exchange chromatography at different pH levels
  • MADI or ESI/LC/Mass Spectrometry ensures that the final product matches your specifications
  • Quality assurance (QA) procedures follow MS, HPLC, and QC analyses to guarantee the highest quality
  • PhD level project managers guide your order through production as we keep you informed of the latest progress
  • Fully traceable ISO 9001 compliance documentation system

Custom RNA Synthesis

RNA Oligos 100 nmol 250 nmol 1 umol 2.5 umol 5 µmol 10 µmol 15 µmol 20 µmol
RNA Oligos $9/base $12/base $16/base $23/base $35/base $55/base $85/base $94/base
2'-OMe-RNA $12/base $16/base $20/base $29/base $52/base $86/base $98/base $133/base
2’-Fluoro C/U $16/base $16/base $20/base $46/base $85/base $150/base $234/base $319/base
2’-Fuoro A/G $39/base $39/base $62/base $117/base $226/base $325/base $455/base $644/base
2’O-MOE $21/base $29/base $39/base $55/base $86/base $156/base $182/base $234/base
BNA $39/base $43/base $62/base $140/base $234/base $390/base $455/base $585/base
LNA $39/base $43/base $62/base $140/base $234/base $390/base $455/base $585/base
Chimeric DNA $1/base $1.30/base $2/base $5/base $10/base $16/base $20/base $23/base
Other Backbone Modification Inquire Inquire Inquire Inquire Inquire Inquire Inquire Inquire

Available Lengths: RNA oligos are available from 10-80 bases for 100 nmole, 5-90 bases for 250 nmole and 1 µmole, and 5-50 bases for 5 µmole and 10 µmole
for sequences >90 bases please contact us or request a quote.

* Desalted Yield: Desalted yield is based on Oligos >25 mer. Shorter sequences or complex sequences may result in lower yield.

Related Products:
Chemical Long RNA Synthesis up to 300 bases
Long RNA Transcripts >1000 bases

imgscroll
Large-Scale RNA Synthesis

We provide RNA oligonucleotide synthesis in quantities ranging from multi-mg to several grams. RNA analogs and chimeras are available from 10 micromoles up to 10 grams! Contact us for more information.

siRNA Arrays

siRNA arrays available in 96-Well-Format with oligos 10-20 bases at 1 ODU deprotected and desalted dry or in liquid format.

RNA Purification 100 nmol 250 nmol 1 umol 2.5 umol 5 umol 10 umol 15 umole 20 umole
RNase-Free PAGE/SEC $98/base $124/base $156/base $312/base $605/base $774/base $1300/base $2210/base
RNase-Free PAGE follow by HPLC $156/base $195/base $260/base $468/base $943/base $1333/base $1723/base $2535/base
RNase-Free IE HPLC $115/base $124/base $137/base $189/base $267/base $332/base $384/base $514/base
RNase-Free RP-HPLC $115/base $124/base $137/base $189/base $267/base $332/base $384/base $514/base
RNase-Free Dual HPLC $176/base $195/base $254/base $332/base $488/base $572/base $650/base $774/base
  • The above prices are for 20 to 50 bases in length. Purity and yield guarantees may vary due to oligo length, modifications, or sequence composition.
  • An additional 1-2 days of turnaround time is required for purifications.
imgscroll

Purification Yields of Unmodified RNA 100 nmol 250 nmol 1 umol 5 umol 10 umol
RNase-Free PAGE 0.5 ODs 2 ODs 8 ODs 35 ODs 65 ODs
RNase-Free IE-HPLC 1 ODs 4 ODs 20 ODs 85 ODs 160 ODs
RNase-Free RP-HPLC 1 ODs 4 ODs 20 ODs 85 ODs 160 ODs
RNase-Free Dual HPLC 0.5 ODs 2 ODs 8 ODs 35 ODs 65ODs
RNase-Free Dual PAGE & HPLC NA 1 ODs 4 ODs 20 ODs 35 ODs
  • The above prices are for 20 to 90 bases in lengt. Purity and yield guarantees may vary due to oligo length, modifications, or sequence composition.
  • Allow for additional 1-2 days required for purification.
imgscroll

Custom Long RNA Oligo Synthesis

Bio-Synthesis is able to chemically synthesizes high quality long RNA of >100 nt. The ability to synthesize longer RNA oligos is highly sequence-dependent due to the potential for secondary structure formation and the inherent difficulty for chemical synthesis of certain sequences. Reduced yield is possible as oligo length increases. We also offer enzymatic RNA synthesis by transcription up to thousands of bases in length using DNA template.

Please contact us to learn more about Chemical Long RNA or Enzymatic Long RNA Synthesis.

Example: Chemical Long RNA Synthesis

Sequence:
GCC ACU UAA ACG ACC UGG AUG UUG CUU UAC UGA AAC UAA AGA AAG UGC AGU UUC CAU UUG GUG GUU AUG GU

Length: 71 nt
Calculated MW: 22765.65
Detected MW: 22766.5

Length

Sequence:

GAAUACUGGAGGGUCAAUACACGUUGGAGUGGCGGACGGGCCGAAGGCGGCGUGAGCGGCGAAGGG
AUGGUGAGGUCGGAGUGGUGAGGCGGAGUCGCGUGGUGAGCGAGCGCGGUGUGGCGUGAGAGGCGUU
CUGCUGGUCAGUAACCAGGU 3'

Length: 153 nt
Calculated MW: 22765.65
Detected MW: 22766.5

Column: Phenomenex,

Column: Phenomenex, Clarity 3u, oligo-RP, 150*2.00 mm, 3 micron Solvent: A 20 mM TEAA, pH 8.0; B: Acetonitrile

5% denaturing PAGE, EtBr staining

5% denaturing PAGE, EtBr staining
Lane 1: 153 nt RNA
Lane 2: RNA Marker

Enzymatic RNA Synthesis

Sequence: 1429 nt

Calculated Mass: 460256.4

Size Analysis: 5% denatured PAGE, EtBr staining
Calculated size: 1429 nt
Observed size: 1429 nt

5% denaturing PAGE picture

5% denaturing PAGE picture, EtBr staining
Lane 1: RNA markers
Lane 2: 1429 nt RNA